Nr3c1 Genotyping: Difference between revisions

From Bridges Lab Protocols
Jump to navigation Jump to search
Reddj (talk | contribs)
No edit summary
Reddj (talk | contribs)
No edit summary
Line 4: Line 4:


Make primer dilution at 1uM (10uL each primer + 980uL water). Primers in '''Genotyping Box'''  are marked with a star.
Make primer dilution at 1uM (10uL each primer + 980uL water). Primers in '''Genotyping Box'''  are marked with a star.
[[ Category:Genotyping ]]
[[ Category:Mouse Work]]
[[ Category:PCR]]
[[ Category:DNA]]
[[ Category:Molecular Biology]]

Revision as of 15:08, 5 June 2020

PRIMERS

  • Fwd: AAACAGGGTTATGCTTGGCA
  • Rev: TGCCTGCTAGGCAAATGATCT

Make primer dilution at 1uM (10uL each primer + 980uL water). Primers in Genotyping Box are marked with a star.