Quantification of miRNA by SYBR Green qPCR: Difference between revisions

From Bridges Lab Protocols
Jump to navigation Jump to search
copied protocol from Pfeffer paper
 
Filled in details about reverse transcriptase
Line 8: Line 8:
* Purify total RNA, via the protocol: [[ Purification of miRNA and mRNA with TRIzol ]]
* Purify total RNA, via the protocol: [[ Purification of miRNA and mRNA with TRIzol ]]
* Superscript III reverse transcriptase (Life Technologies Catalog # 18080093)
* Superscript III reverse transcriptase (Life Technologies Catalog # 18080093)
* Oligo dT Adapter Primer '''5'GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3'''
* Oligo dT Adapter Primer '''5'GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3''', dissolved to 50 uM
* dNTP Mixture (10 mM of each)
* Reverse Adapter Sequence '''5'GCGAGCACAGAATTAATACGACTCAC-3'''
* Reverse Adapter Sequence '''5'GCGAGCACAGAATTAATACGACTCAC-3'''
* Mature miRNA Primer
* Mature miRNA Primer
Line 14: Line 15:
==Protocol==
==Protocol==


===Reverse Transcriptase==
===Reverse Transcriptase===
* Reverse-transcribed into first-strand cDNA using Superscript III transcriptase (Invitrogen) with the oligo-dT adapter primer
* Reverse-transcribed into first-strand cDNA using Superscript III transcriptase (Invitrogen) with the oligo-dT adapter primer
* Add to a PCR tube (this is per reaction):
** 1 uL of Oligo dT Primer
** 1uL of dNTP
** 500 ng of RNA
** Sterile water up to 13 uL
* Heat at 65C for 5 minutes
* Briefly centrifugre then add (per reaction):
** 4 uL 5X First Strand Buffer
** 1 uL 0.1M DTT
** 1 uL RNAseOUT
** 1 uL of Superscript III RT
* Mix gently by pipetting and place in the PCR machine for the following program:
** Incubate at 50C for 60 min
** Inactivate by heating at 70C for 15 min
===qPCR===
===qPCR===
* 40ng of cDNA was used as a template in each reaction.  
* Try 50ng of cDNA was as a template in each reaction (1/10th of the cDNA mixture).  
* The reverse primer was from the adapter sequence:  5'GCGAGCACAGAATTAATACGACTCAC3' and the forward primers were specific to miRNA mature sequences.   
* The reverse primer was from the adapter sequence:  5'GCGAGCACAGAATTAATACGACTCAC3' and the forward primers were specific to miRNA mature sequences.   
* The SYBR Green-based real-time PCR was performed to quantify miRNA expression, and U6 can be used for normalization.
* The SYBR Green-based real-time PCR was performed to quantify miRNA expression, and U6 can be used for normalization.
* Can use a protocol similar to the [[ QPCR ]] for mRNA quantification

Revision as of 21:05, 20 July 2015


This is adapted from Pfeffer et al 2015

Materials

  • Purify total RNA, via the protocol: Purification of miRNA and mRNA with TRIzol
  • Superscript III reverse transcriptase (Life Technologies Catalog # 18080093)
  • Oligo dT Adapter Primer 5'GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3, dissolved to 50 uM
  • dNTP Mixture (10 mM of each)
  • Reverse Adapter Sequence 5'GCGAGCACAGAATTAATACGACTCAC-3
  • Mature miRNA Primer

Protocol

Reverse Transcriptase

  • Reverse-transcribed into first-strand cDNA using Superscript III transcriptase (Invitrogen) with the oligo-dT adapter primer
  • Add to a PCR tube (this is per reaction):
    • 1 uL of Oligo dT Primer
    • 1uL of dNTP
    • 500 ng of RNA
    • Sterile water up to 13 uL
  • Heat at 65C for 5 minutes
  • Briefly centrifugre then add (per reaction):
    • 4 uL 5X First Strand Buffer
    • 1 uL 0.1M DTT
    • 1 uL RNAseOUT
    • 1 uL of Superscript III RT
  • Mix gently by pipetting and place in the PCR machine for the following program:
    • Incubate at 50C for 60 min
    • Inactivate by heating at 70C for 15 min

qPCR

  • Try 50ng of cDNA was as a template in each reaction (1/10th of the cDNA mixture).
  • The reverse primer was from the adapter sequence: 5'GCGAGCACAGAATTAATACGACTCAC3' and the forward primers were specific to miRNA mature sequences.
  • The SYBR Green-based real-time PCR was performed to quantify miRNA expression, and U6 can be used for normalization.
  • Can use a protocol similar to the QPCR for mRNA quantification