Preparing an Adenoviral shRNA Clone: Difference between revisions

From Bridges Lab Protocols
Jump to navigation Jump to search
Created page with '==Choosing a shRNA Sequence== Use oligoengine to pick a sequence, for example <span style="color:#FF0000">GATC</span><span style="color:#00FFFF">CCC</span>GAATACCGCAATGCCTTAG<spa...'
 
No edit summary
Line 7: Line 7:
*<span style="color: #00FFFF">Spacer</span>
*<span style="color: #00FFFF">Spacer</span>
*<span style="color:#FFD700">Loop</span>
*<span style="color:#FFD700">Loop</span>
*In black is the target shRNA sequence, both forward and then after the loop as a reverse complement.


For the reverse primer choose the reverse complement, remove the XbaI overhang from the 3' end (the last GATC sequence) and add an AGTC sequence to the 5' end (for HindIII).
For the reverse primer choose the reverse complement, remove the XbaI overhang from the 3' end (the last GATC sequence) and add an AGTC sequence to the 5' end (for HindIII).
Order primers through IDT-DNA
Order primers through IDT-DNA

Revision as of 18:21, 23 August 2010

Choosing a shRNA Sequence

Use oligoengine to pick a sequence, for example GATCCCCGAATACCGCAATGCCTTAGTTCAAGAGACTAAGGCATTGCGGTATTCTTTTTA

Where:

  • XbaI compatible overhang
  • Spacer
  • Loop
  • In black is the target shRNA sequence, both forward and then after the loop as a reverse complement.

For the reverse primer choose the reverse complement, remove the XbaI overhang from the 3' end (the last GATC sequence) and add an AGTC sequence to the 5' end (for HindIII). Order primers through IDT-DNA