Quantification of miRNA by SYBR Green qPCR: Difference between revisions

From Bridges Lab Protocols
Jump to navigation Jump to search
Added RNA tailing
updated with some clarifications
 
Line 6: Line 6:
see [[ SOP - Chloroform ]] for safety information about working with Chloroform.
see [[ SOP - Chloroform ]] for safety information about working with Chloroform.


This is adapted from [http://dx.doi.org Yang ''et al'' 2010]  
This is adapted from [http://dx.doi.org/10.1158/0008-5472.CAN-10-2579 Yang ''et al'' 2010]  
==Materials==
==Materials==
* Purify total RNA, via the protocol: [[ Purification of miRNA and mRNA with TRIzol ]]
* Purify total RNA, via the protocol: [[ Purification of miRNA and mRNA with TRIzol ]]
Line 14: Line 14:
* Isopropanol
* Isopropanol
* Superscript III reverse transcriptase (Life Technologies Catalog # 18080093)
* Superscript III reverse transcriptase (Life Technologies Catalog # 18080093)
* Oligo dT Adapter Primer '''5'GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3''', dissolved to 50 uM
* miRNA Oligo dT Adapter Primer '''5'GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3''', dissolved to 50 uM
* dNTP Mixture (10 mM of each)
* dNTP Mixture (10 mM of each).  Note this is not the normal 1 mM dNTP stock in the lab.
* Reverse Adapter Sequence '''5'GCGAGCACAGAATTAATACGACTCAC-3'''
* Reverse Adapter Sequence '''5'GCGAGCACAGAATTAATACGACTCAC-3'''
* Mature miRNA Primer
* Mature miRNA Primer, this is a gene specific primer corresponding to the mature miRNA sequence.


==Protocol==
==Protocol==
Line 32: Line 32:
* Transfer the upper (aqueous) layer to a clean tube.  Add 200 uL chloroform and mix, spin and extract aqueous layer to a new tube twice to remove the excess phenol
* Transfer the upper (aqueous) layer to a clean tube.  Add 200 uL chloroform and mix, spin and extract aqueous layer to a new tube twice to remove the excess phenol
* Add 140 uL of isopropanol, mix and incubate 5 minutes.  Centrifuge 15 minutes on max.  Aspirate supernatant being careful not to touch the pellet and air dry for 5-10 mins
* Add 140 uL of isopropanol, mix and incubate 5 minutes.  Centrifuge 15 minutes on max.  Aspirate supernatant being careful not to touch the pellet and air dry for 5-10 mins
* Reedissolved in 25 μL of water
* Redissolved in 6 μL of water


===Reverse Transcriptase===
===Reverse Transcriptase===
* Reverse-transcribed into first-strand cDNA using Superscript III transcriptase (Invitrogen) with the oligo-dT adapter primer
* Reverse-transcribed into first-strand cDNA using Superscript III transcriptase (Invitrogen) with the oligo-dT adapter primer
* Add to a PCR tube (this is per reaction):
* Add to an eppendorf tube (this is per reaction):
** 1 uL of Oligo dT Primer
** 1 uL of miRNA Oligo dT Adapter Primer
** 1uL of dNTP
** 1uL of dNTP
** 6uL of tailed RNA
** 6uL of tailed RNA
** 5 uL Sterile water
** 5 uL Sterile water
* Heat at 65C for 5 minutes
* Heat at 65C for 5 minutes in the heating block.
* Briefly centrifugre then add (per reaction):
* Briefly centrifuge then transfer to a PCR tube and add (per reaction):
** 4 uL 5X First Strand Buffer
** 4 uL 5X First Strand Buffer
** 1 uL 0.1M DTT
** 1 uL 0.1M DTT
** 1 uL RNAseOUT
** 1 uL RNAseOUT
** 1 uL of Superscript III RT
** 1 uL of Superscript III RT
* Mix gently by pipetting and place in the PCR machine for the following program:
* Mix gently by pipetting and place in the PCR machine for the following program (called '''SS III Reaction'''):
** Incubate at 50C for 60 min
** Incubate at 50C for 60 min
** Inactivate by heating at 70C for 15 min
** Inactivate by heating at 70C for 15 min
* Can store the tailed cDNA at -20 until qPCR


===qPCR===
===qPCR===
* Try 50ng of cDNA was as a template in each reaction (1/10th of the cDNA mixture).  
* Generally use 100 ng of cDNA was as a template in each reaction (1/10th of the cDNA mixture).  
* The reverse primer was from the adapter sequence:  5'GCGAGCACAGAATTAATACGACTCAC3' and the forward primers were specific to miRNA mature sequences.   
* The reverse primer was from the adapter sequence:  5'-GCGAGCACAGAATTAATACGACTCAC-3' and the forward primers were specific to miRNA mature sequences.   
* The SYBR Green-based real-time PCR was performed to quantify miRNA expression, and U6 can be used for normalization.
* The SYBR Green-based real-time PCR was performed to quantify miRNA expression, and U6 can be used for normalization.
* Can use a protocol similar to the [[ QPCR ]] for mRNA quantification
* Can use a protocol similar to the [[ QPCR ]] for mRNA quantification

Latest revision as of 15:24, 1 March 2017


see SOP - Chloroform for safety information about working with Chloroform.

This is adapted from Yang et al 2010

Materials

  • Purify total RNA, via the protocol: Purification of miRNA and mRNA with TRIzol
  • PolyA polymerase (NEB cat# M0276S)
  • Phenol/Choroform mixture (1:1 ratio)
  • 3M Sodium acetate pH 5.2
  • Isopropanol
  • Superscript III reverse transcriptase (Life Technologies Catalog # 18080093)
  • miRNA Oligo dT Adapter Primer 5'GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3, dissolved to 50 uM
  • dNTP Mixture (10 mM of each). Note this is not the normal 1 mM dNTP stock in the lab.
  • Reverse Adapter Sequence 5'GCGAGCACAGAATTAATACGACTCAC-3
  • Mature miRNA Primer, this is a gene specific primer corresponding to the mature miRNA sequence.

Protocol

PolyA Tailing of RNA

  • Incubate at 37°C for 1 hour. Components include
    • 1 ug RNA
    • 2 uL 10X polymerase reaction buffer
    • 2 uL ATP (10 mM, comes with polymerase)
    • 1 uL poly(A) polymerase
    • ddH2O to a final volume of 20 uL
  • Add 160 uL Water, 20 uL of 3 M sodium acetate, pH 5.2 and 200 uL of phenol/chloroform to tailed RNA, mix by tapping to form an emulsion
  • Centrifuge for 1 min on max to separate layers
  • Transfer the upper (aqueous) layer to a clean tube. Add 200 uL chloroform and mix, spin and extract aqueous layer to a new tube twice to remove the excess phenol
  • Add 140 uL of isopropanol, mix and incubate 5 minutes. Centrifuge 15 minutes on max. Aspirate supernatant being careful not to touch the pellet and air dry for 5-10 mins
  • Redissolved in 6 μL of water

Reverse Transcriptase

  • Reverse-transcribed into first-strand cDNA using Superscript III transcriptase (Invitrogen) with the oligo-dT adapter primer
  • Add to an eppendorf tube (this is per reaction):
    • 1 uL of miRNA Oligo dT Adapter Primer
    • 1uL of dNTP
    • 6uL of tailed RNA
    • 5 uL Sterile water
  • Heat at 65C for 5 minutes in the heating block.
  • Briefly centrifuge then transfer to a PCR tube and add (per reaction):
    • 4 uL 5X First Strand Buffer
    • 1 uL 0.1M DTT
    • 1 uL RNAseOUT
    • 1 uL of Superscript III RT
  • Mix gently by pipetting and place in the PCR machine for the following program (called SS III Reaction):
    • Incubate at 50C for 60 min
    • Inactivate by heating at 70C for 15 min
  • Can store the tailed cDNA at -20 until qPCR

qPCR

  • Generally use 100 ng of cDNA was as a template in each reaction (1/10th of the cDNA mixture).
  • The reverse primer was from the adapter sequence: 5'-GCGAGCACAGAATTAATACGACTCAC-3' and the forward primers were specific to miRNA mature sequences.
  • The SYBR Green-based real-time PCR was performed to quantify miRNA expression, and U6 can be used for normalization.
  • Can use a protocol similar to the QPCR for mRNA quantification